INTRODUCTION:

Staphylococci are gram positive bacteria, which form grape like clusters. Almost 30% of the normal healthy population is affected by Staphylococcus aureus (S.aureus) as it asymptomatically colonize human host^[1]. Infection range from minor skin infections to life threatening conditions such as endocarditis, pneumonia and septicemia. Skin and soft tissue infections (SSTIs) are a common manifestation of staphylococcal disease in many community outbreaks, with invasive staphylococcal disease being less common^[2].

Antibiotics resistance in Staphylococcus aureus has become an ever increasing problem. Over the last decade, a considerable increase in the prevalence of MRSA (Methicillin resistant Staphylococcus aureus) has been reported from almost every region of the world.^[3] There are two major strains of MRSA: hospital-acquired MRSA (HA-MRSA) and community acquired MRSA (CA-MRSA). They have been proven to be genetically distinct with respect to the SCC mec type, most HA-MRSA strains carry one of three types of SCC mec (Type 1,2 or 3). On the other hand, CA-MRSA carry smaller SCC mec elements, usually Type 4, and to a lesser extent Type 5. CA-MRSA is often less resistant to antibiotics than HA-MRSA. CA-MRSA can colonise healthy individuals and can also cause skin and soft tissue infections and necrotizing pneumonia. MRSA produces a wide variety of virulence factors that contribute to its pathogenesis as Panton-Valentine Leukocidin (PVL)^[3].

PVL is a bicomponent cytolytic toxin encoded by two genetic elements called lukF-PV and lukS-PV genes, which are carried by a group of specific bacteriophages. PVL has been linked to skin, soft tissue infections and necrotizing pneumonia (Deurenberg et al., 2007)^[4].PVL is commonly found in CA-MRSA strains and appears to be associated with increases disease severity. Presently MRSA-PVL positive isolates are increasingly reported in healthcare systems^[3].The present study was conducted to detection of panton valentine leukocidin gene in methicillin resistant staphylococcus aureus isolated from both in-patients and out-patients at Saveetha medical college, thandalam, Chennai. PVL is more commonly found in CA-MRSA but the result of the present study indicates that nowadays it found even in HA-MRSA.

MATERIALS AND METHODS:

The study was conducted at Saveetha Medical College and Hospital, Thandalam, Chennai in the department of Microbiology during the period from February 2017 to july 2017.

A total number of 244 strains of S. aureus isolated from clinical samples were used in the study. Confirmation of the strains was done using standard tests like catalase, slide and tube coagulase. Routine antibiotic susceptibility testing was performed by Kirby-Bauer disc diffusion method according to CLSI guidelines^[5].

Cefoxitin disc diffusion test:

Cefoxitin (30µg) disc was placed on Mueller Hinton agar plates previously inoculated with 0.5 McFarland bacterial suspension. Plates were incubated at 33-35˚c for 16-18 hours. The inhibitory zone measuring less than 21mm were considered as resistant while zone measuring more than 22mm were considered as susceptible^[5].

Cloxacillin disc diffusion test:

Cloxacillin (5µg) disc was placed on Mueller Hinton agar plates previously inoculated with 0.5 Mc Farland bacterial suspension. Plates were incubated at 33-35˚c for 16-18 hours. The inhibitory zone measuring less than 17mm were considered as resistant while zone measuring more than 18mm were considered as susceptible^[5].

Oxacillin agar screening test:

Mueller Hinton agar (MHA) plates containing 4% NaCl and 6µg/ml of oxacillin were prepared. Plates were inoculated with 10µL of 0.5McFarland suspension of the isolate by streaking in one quadrant and incubated at 35˚c for 24hours. Plates were observed carefully in transmitted light for any growth. Any growth after 24 hours was considered oxacillin resistant^[5].

Polymerase chain reaction:

The genomic DNA was extracted by using DNA extraction kit and the primers were custom synthesized. The sequences of the primers used for gene amplification are presented in Table 1. Polymerase chain reaction (PCR) for the detection of pvl gene was performed according to the methods described by Merlino et al., (2002) and Lina et al., (1999)^[6,7]. Briefly, amplification reactions were performed in a 25µL mixture containing 12.5µL of 2X PCR master mix (Amplicon, Denmark), 10pmol of each primers and 2µL of DNA template and the final volume was adjusted to 25µL by adding nuclease free water. Amplification reactions were performed using a DNA thermal cycler (Master cycler gradient, Eppendorf, Germany) with the following program: for pvl gene denaturation 10minutes at 95˚c, followed by 30 cycles of denaturation for 3 seconds at 94˚c, annealing for 5 seconds at 52˚c and extension for 18 seconds at 72˚c and final extension for 5 minutes at 72˚c. The PCR products were stained with 1% solution of ethidium bromide and visualized under UV light after gel electrophoresis on 2.0% agarose gel. Nuclease free water was used as the negative control.

RESULTS:

In this study a total number of 244 Staphylococcus aureus isolates were collected from both out patients and in-patients of Saveetha Medical College and Hospital, Thandalam, Chennai a period of 6 months from February 2017 to July 2017. Exudates samples were collected from both in-patients and out-patients.

The results of the present study revealed that 244/1067 of the samples were positive for the presence of S.aureus in that 206 from in-patients and 38 from out-patients. Out of 244 Staphylococcus aureus isolated, 48 (19.6%) were resistant to cefoxitin, 45 (18.4%) were resistant to cloxacillin and 38(15.5%) were showing growth in oxacillin agar medium are presented in figure 1. This Shows that cefoxitin disc diffusion assay has more sensitive compare with cloxacillin disc diffusion assay and oxacillin agar medium method. Out of 48 samples yielding MRSA, 30(62.5%) were from male patients and 18 (37.5%) were from female patients. Out of the 48 MRSA samples 39 (18.93%) were from in-patients and only 9(23.68%) were in out-patients.

Figure No1: Comparison between cefoxitin, cloxacillin and oxacillin agar method for detection of MRSA

MRSA isolates were highly resistant to cotrimoxazole (77.08%), penicillin(100%) as shown in Table No .1

Table No 1: Antibiotic sensitivity pattern of MRSA

Antibiotics	Sensitive	Resistance
Penicillin	0	48(100%)
Erythromycin	21(43.75%)	27(56.25%)
Clindamycin	28(58.3%)	20(41.6%0
Gentamycin	18(37.5%)	30(62.5%)
Vancomycin	48(100%)	0
Ciprofloxacin	4(8.33%)	44(91.6%)
Ofloxacin	6(12.5%)	42(87.5%)
Ampicillin	27(56%)	21(43%)
Linezolid	48(100%)	0
Cefoxitin	0	48(100%)
Cephalexin	0	48(100%)

Among 48 MRSA isolates, Vancomycin and Linezolid 48/48 (100%) shown highest susceptibility to MRSA. 27(56%) were sensitive to Ampicillin 28(58.3%) were sensitive to clindamycin, 21(43.75%) were sensitive to erythromycin, 18(37.5%) were sensitive to gentamycin, 11(22.91%) were sensitive to cotrimoxzole, 4(8.33%) were sensitive to ciprofloxacin, and 6(12.5%) were sensitive to ofloxacin.

MOLECULAR METHOD:

Out of 48 MRSA isolates 10 isolates which showed resistant to ciprofloxacin and ofloxacin were subjected to PCR to find out the PVL producing gene. Out of 10 samples 5 were from in-patients and 5 were from out-patients. Among 10 samples 6 were showing positivity for PVL gene. In that 4 were from in-patients and 2 were from out-patients.

Table: 2 Primer used in this study

Target gene

Primer sequence (5 ̍ to 3 ̍ )

Amplicon size

PVL (FP)

GTAAAATGTCTGGACATGATCCA

421bp

PVL (RP)

GCTTTTGCTATCCAATACAGTTG

FP – Forward primer , RP –Reverse primer

Figure No 2: The band pattern was visualized for PVL- gene

Top Lane 1- 50bp DNA ladder; From Lane 2—5 Samples;

Down Lane 1: 50bp DNA Ladder; From Lane 2-7 Positive Samples duplicates

Amplicon Size: 421bp

Interpretation:

PVL gene is present in the six samples out of 10. For reconfirmation, amplification with duplication of each samples shown the presence of PVL gene in samples 19, 1375, 1303,1311,1388 and 1512.

DISCUSSION:

The global emergence of MRSA is a significant challenge for public health^[8-10]. Recently, new variants with grave characteristics have been found. These variants are known as CA-MRSA because they are primarily found in communities and among people without the risk factors of infection. Community-acquired MRSA can cause soft-tissue infections and deep dermal infections and usually carry the PVL gene^[11,12]. In fact, 2 groups of MRSA bacteria have already been identified: CA-MRSA and HA-MRSA, and the isolates had multiple antibiotic resistances^[13]. Infections due to MRSA bacteria in the community has been proven and is known as CA-MRSA infection^[14,15]. Presently MRSA-PVL positive isolates are increasingly reported in healthcare systems^[16].

In this study, MRSA accounted for 19.67% of the isolated strains. So in our hospital infection control is better than the other study conducted by K. Rajaduraipandi et.al.,^[17]demonstrated that MRSA accounted for 29.1%.

In this study we compare the method which is used routinely for MRSA screening in our hospital cefoxitin disc diffusion with cloxacillin disc diffusion and oxacillin agar method. In that most of the isolates were resistant to cefoxitin comparing with cloxacillin disc 93.75% and oxacillin agar method (79.16%). So cefoxitin is the more precise method for MRSA detection. This is correlated with the other studies by (Pramodhini et al., 2015; Kali et al., 2014; Vyas et al., 2015) ^[18,19,20]. The higher sensitivity to cefoxitin can be explained by the increased expression of the mecA-encoded protein PBP2a, as cefoxitin being an inducer of the mecA gene.

In our study, more strains isolated from pus and wound swabs 39(81.2%) and this correlates to the study by (Qureshi et.al.,)^[21] reported a high isolation rate of MRSA (83%) from pus and wound swabs. Infection by Staphylococcus spp. are often associated with wounds, especially in hospitalized patients. Wounds may be the source of bacteria causing cross-contamination, and are a risk factor for Methicillin- resistant Staphylococcus aureus (MRSA) infection.

In present study, while determining the antibiotic susceptibility pattern for the 48 MRSA isolates, highest susceptibility was found for vancomycin and linezolid 48/48 (100%) by Kirby Bauer disc diffusion method. This was in concordance with the study done by (Tashmin Afroz Binte Islam et al., 2015;)^[22]were a maximum sensitivity of 100% was detected for both vancomycin and linezolid. In present study, the drug with least susceptibility was ciprofloxacin and ofloxacin for which only (91.6%) and (87.5%). Similar results of over 90% resistance have been reported in some studies from India (Sarma JB et al., 2010;)^[23]and Pakistan (Qureshi AH et al., 2004;)^[21]. Resistance of MRSA to penicillin (100%) and this correlates to the study by (Anbumani N et al., 2006; Tiwari HK et al., 2008; Pai V et al., 2010;) ^[24,25,26].This study reveals that multi drug resistance in MRSA is common problem.

PVL has gained much importance in the recent years due to its association with the CA- MRSA infection. Nowadays PVL gene detected even in HA-MRSA. The S. aureus strains with PVL have been found to be rapidly spreading and cause serious skin and soft tissue infections such as pyomyositis, abscesses, breast abscesses, necrotizing fasciitis and pneumonia.

In this study, a Real Time PCR was used for specific detection of PVL gene. 10 isolates which showed resistant to ciprofloxacin and ofloxacin were subjected to PCR to find out the PVL producing gene. Out of 10 samples 5 were from in-patients and 5 were from out-patients. The prevalence of PVL toxin in this study was 6. In that 4 were from in-patients and 2 were from out-patients is correlates with the other study conducted in Germany 2007 by (Wagenlehner FM Naber KG Bamble E et al., 2007;)^[27]prevalence of MRSA isolates among inpatients was reported at 11.3%, among which 9.1% of the isolates were PVL positive.

CONCLUSION:

In conclusion, the degree of resistance or sensitivity of MRSA towards commonly used antibiotics is recognized to be diverse from region to region, vancomycin and linezolid was found to give uniform sensitivity(100%). But nowadays there is rise to multidrug resistant in S. aureus. So indiscriminate use of antibiotics should be avoided and therapy should be advocated only after performing culture and sensitivity. PVL gene which is one of the virulent factor of Staphylocccus aureus. This virulence factor that allow it to adhere to surface, invade or avoid the immune system, and cause harmful toxic effects to the host. PVL is more commonly found in CA-MRSA. But nowadays it found even in HA-MRSA. Rapid and informative molecular typing is essential for early identification of PVL positive MRSA strains to prevent spreading of these strains in hospitals. In the future, screening for the PVL as a virulence factor in S. aureus may become a routine laboratory procedure.

REFERENCES:

1. Gill SR, Fouts DE, Archer GL, Moungdoun EF, Deboy RT, Ravel J, et al. insights on evolution of virulence and resistance from the complete genome analysis on early methicillin resistant Staphylococcus aureus strain and a bio-film producing methicillin resistant Staphylococcus epidermidis strain. J Bacterial 2005; 187: 2426-38.

2. venkataraghavendrarao, A. Kavitha, K.S. Seetha et al., prevalence of inducible clindamycin resistance among clinical isolates of Staphylococci- National journal of basic medical sciences vol 3, issue 1

3. Mohanasundaram K M et al the prevalence of inducible clindamycin resistance among gram positive cocci from various clinical specimens. Journal of clinical research 2011 feb,vol-5(1) 38-40

4. Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcal aureus. ClinMicrobiol Infect. 2007;13:222-235.

5. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Tests; Approved Standards; Doucement M2-A9, 9^th ed., Vol 26. Wayne, PA:CLSI;2015

6. Merlino, J., J. Watson and Rose, B. 2002. Detection and expression of methicillin/oxacillin resistance in multidrug resistant and non-multidrug resistant Staphylococcus aureus in central Sydney, Australia. J. Antimicrob. Chemother. 49:793-798.

7. Lina, G., Y. Piemont, F. Godail-Gamot, M. Bes, M.O. Peter, V. Gauduchon, F. Vandenesch and Etienne, J. 1999. Involvement of Panton valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia.Clin. Infect. Dis. 29:1128-1132.

8. Chambers HF. Community-associated MRSA-Resistance and virulence converge. N Engl J Med. 2005;352:1485-1487.

9. Fridkin SK Hageman JC Morrison M et al. Methicillin-resistant Staphylococcus aureus disease in three communities. N Engl J Med.2005;352:1436-1444

10. Kazakova SV Hageman JC Matava M et al. A clone of methicillin-resistant Staphylococcus aureus among professional football players. N Engl J Med.2005;352:468-475

11. Okuma K lwakawa K Turnidge JD et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J Clin Microbiol.2002;40:4289-4294.

12. Tristan A Bes M Meugnier H et al. Global distribution of Panton valentine leukocidin-positive methicillin-resistant Staphylococcus aureus,2006.Emerg Infect Dis.2007;13:594-600.

13. Oliveira DC Tomasz A de Lencastre S. secrets of success of a human pathogen: Molecular evolution of pandemic clones of methicillin resistant staphylococcus aureus. Lancet Infect Dis. 2002;2:180-189

14. Wertheim HF Melles DC Vos MC et al. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect Dis. 2005;5:751-762

15. Tristan A Bes M Meugnier H et al. Global distribution of Panton-valentine leukocidin-positive methicillin-resistant Staphylococcus aureus,2006;13:594-600

16. Linde H Wagenlehner F Strommenger B et al. Healthcare-associated outbreaks and community-acquired infections due to MRSA carrying the Panton-valentine leukocidin gene in southeastern Germany. Eur J Clin Microbiol Infect Dis. 2005; 24:419-422

17. Rajadurapandi K, Mani KR, Panneerselva, K, et al., Prevalence and antimicrobial susceptibility pattern of methicillin resistant Staphylococcus aureus: a multicentre study. Indian J med microbial. 2006; 24:34-8

18. Pramodhini, S., P.R. Thenmozhivalli, R. Selvi, V. Dillirani, A. Vasumathi and Agatha,D. 2011. Comparison of Various Phenotypic Methods and mecA Based PCR for the Detection of MRSA. Journal of Clinical and Diagnostic Research. 5(7): 1359-1362.

19. Kali, A., S. Stephen and Umadevi, S. 2014. Laboratory evaluation of phenotypic detection of methicillin resistant Staphylococcus aureus. Biomed J.37:411-414

20. Vyas, A., M. Sharma, S. Kumar, M. Kumar and Mehra, S.K. 2015. A comparative study of oxacillin screen agar, oxacillin disc diffusion and cefoxitin disc diffusion, oxacillin E-test method for routine screening of methicillin resistant S. aureus .International Journal of Current Research and Review. 7(10):55-60.

21. Qureshi AH, Rafi S, Qureshi SM et al., The current susceptibility patterns of methicillin resistant Staphylococcus aureus to conventional anti Staphylococcus antimicrobials at Rawalpindi. Pak J Med sci.2004;20:361-4

22. Tashmin Afroz Binte Islam, S.M. Shamsuzzaman et al., Prevalence and antimicrobial susceptibility pattern of methicillin-resistant, vancomycin-resistant, and Panton valentine leukocidin positive Staphylococcus aureus in a tertiary care hospital Dhaka, Bangladesh. Tzu Chi Medical Journal volume 27, Issue 1, March 2015, Pages 10-14.

23. Sarma JB, Ahmed GU. Characterization of methicillin resistant S. aureus strains and risk factors for acquisition in a teaching hospital in northeast India. Indian J Med Microbiol.2010;28:127-9.

24. Anbumani N, Kalyani J, Mallika M. Prevalence of methicillin-resistant Staphylococcus aureus in a Tertiary Refferel Hospital in Chennai, South India. Indian J Pract Doct 2006-08-2006-09.:3.

25. Tiwari HK, Sapkota D, Sen RM. High prevalence of multidrug-resistant MRSA in a tertiary care hospital of northern India. Infect Drug Resist. 2008;1:57-61

26. Pai V, Rao VI, Rao SP. Prevalence and antimicrobial susceptibility pattern of methicillin-resistant Staphylococcus aureus (MRSA) isolates at a tertiary care hospital in Manglore, South India. J Lab Physicians.2010;2:82-4.

27. Wagenlehner FM Naber KG Bambl E et al. Management of a large healthcare-associated outbreakof Panton valentine leukocidin-positive methicillin-resistant Staphylococcus aureus in Germany. J Hosp Infect. 2007;67:114-120

Received on 23.03.2018 Modified on 12.05.2018

Research J. Pharm. and Tech 2019; 12(2):508-512.

DOI: 10.5958/0974-360X.2019.00089.1